Fotos / Sonidos

Qué

Hongos de Saco, Levaduras Y Parientes (Filo Ascomycota)

Fecha

Junio 28, 2024 a las 11:17 MAÑANA MDT

Descripción

Specimen not collected, no host insect found.

Fotos / Sonidos

Qué

Hongos Bonete (Género Mycena)

Observ.

jasonheadley

Fecha

Junio 6, 2024 a las 11:05 MAÑANA MDT

Descripción

This observation was made with the landowner's authorization. Access to this private property is restricted and all activities are carried out with permission.

Fotos / Sonidos

Observ.

mycosphaera

Fecha

Mayo 15, 2024 a las 03:52 TARDE EDT

Descripción

MRD0082

Habitat : Forêt mixte (Acer saccharum, Betula alleghaniensis, Picea glauca, Tsuga canadensis)
Substrat : Souche en décomposition (probablement feuillu)

Etiquetas

Fotos / Sonidos

Observ.

friendlyforest

Fecha

Junio 13, 2024 a las 12:17 TARDE EDT

Fotos / Sonidos

Observ.

myconemo

Fecha

Junio 16, 2024 a las 03:57 TARDE MDT

Fotos / Sonidos

Observ.

stucumber

Fecha

Febrero 2024

Descripción

Trailside in Ceanothus leaf litter. Cespitose, decurrent gills, darkened central depression of cap. Odorless, mild taste, no UVF.

Fungi

Fotos / Sonidos

Qué

Hongos (Reino Fungi)

Observ.

myconemo

Fecha

Junio 16, 2024 a las 04:47 TARDE MDT

Fotos / Sonidos

Observ.

bradenjudson

Fecha

Junio 16, 2024 a las 03:36 TARDE PDT

Fotos / Sonidos

Fecha

Junio 14, 2024 a las 02:50 TARDE MDT

Fotos / Sonidos

Observ.

kallummcdonald

Fecha

Junio 2024

Fotos / Sonidos

Observ.

kyronb

Fecha

Junio 12, 2024 a las 12:13 TARDE PDT

Fotos / Sonidos

Qué

Micena Naranja (Mycena leaiana)

Observ.

abstickz

Fecha

Junio 9, 2024 a las 12:07 TARDE ADT

Fotos / Sonidos

Observ.

kallummcdonald

Fecha

Junio 7, 2024 a las 06:46 TARDE MDT

Fotos / Sonidos

Fecha

Mayo 24, 2024 a las 06:20 TARDE MDT

Fotos / Sonidos

Observ.

haveyoubirdofit

Fecha

Junio 3, 2024

Descripción

Located in recently burned forest.

Fotos / Sonidos

Fecha

Junio 4, 2024 a las 04:04 TARDE MDT

Fotos / Sonidos

Qué

Hongos Alucinógenos Cabeza de Cono (Género Conocybe)

Observ.

vail

Fecha

Octubre 22, 2023

Fotos / Sonidos

Observ.

vail

Fecha

Octubre 13, 2023 a las 03:06 TARDE PDT

Descripción

Mild earthy smell and taste.
Collected

Fotos / Sonidos

Observ.

vail

Fecha

Octubre 20, 2023 a las 03:33 TARDE PDT

Descripción

Growing under a big red alder log.
Very delicate.
Mild smell and taste.

Fotos / Sonidos

Observ.

vail

Fecha

Octubre 12, 2023 a las 09:18 MAÑANA PDT

Descripción

Mild earthy smell.

Fotos / Sonidos

Observ.

vail

Fecha

Octubre 15, 2023 a las 10:35 MAÑANA PDT

Descripción

Coltricia?

Fotos / Sonidos

Qué

Bejines, Pedos de Lobo Y Parientes (Familia Lycoperdaceae)

Observ.

davis_prairie

Fecha

Noviembre 5, 2023 a las 10:08 MAÑANA MST

Descripción

Amazing purple spores. Native prairie southern Alberta

Fotos / Sonidos

Fecha

Mayo 29, 2024 a las 06:35 TARDE MDT

Fotos / Sonidos

Qué

Hongo Silla de Montar (Cerioporus squamosus)

Observ.

cbrdar

Fecha

Mayo 27, 2024 a las 06:38 TARDE EDT

Descripción

On large rotting sugar maple stump. Huge! 30 cm wide.

Fotos / Sonidos

Fecha

Mayo 23, 2024 a las 03:39 TARDE MDT

Fotos / Sonidos

Observ.

peoplemcnuggett

Fecha

Mayo 20, 2024 a las 04:13 TARDE MDT

Descripción

Growing from incubated moose dung

Fotos / Sonidos

Qué

Hongos con Láminas (Orden Agaricales)

Observ.

kabea

Fecha

Mayo 18, 2024 a las 04:53 TARDE MDT

Fotos / Sonidos

Fecha

Mayo 15, 2024 a las 01:22 TARDE MDT

Fotos / Sonidos

Observ.

dustin777

Fecha

Mayo 13, 2024 a las 05:12 TARDE MDT

Descripción

Didn’t have anything for precise measurements. Used a dime to highlight relative size.

Fotos / Sonidos

Observ.

paleoleaves

Fecha

Mayo 11, 2024 a las 01:20 TARDE MDT

Fotos / Sonidos

Observ.

costello

Fecha

Septiembre 20, 2020 a las 05:17 TARDE MDT

Descripción

DNA sequence recorded.
Specimens stored in Alberta Mycological Fungarium

Found garden soil while digging up potatoes. Nearby trees include crabapple, aspens and spruce.

GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCAATATCTGGGATGCCAAAGACACAGGCTCCCGATAAAACACATTTATGCGTATCCTTCCATGTTGCTTTCCCAGGCCAGTGGCCACTGCTGCCAGCCATGCCGCTTTTCGGTTACATGGTTGAGGTGCTTGGGGAAGGGCTAATTATCAAACTTTACTTCACCTTATTGTCTGAGAAGGCCATGTGCCGTAATCTTTAAACATGTTAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCGCAAAAACCCAGATCACCTAGAGTGTGGTATTGGCAGAAGTGGCCGGGGCTATCAGCGCTGCTGCCACTCTGCTGGAATGAATAGGCTGGAAAAGTAGATCATAGCAACAGACTTTCACAGTATTTTGAAATGCTAAATTAGTTTGAAGCTGATCGGAACCTAAGCCATTTGACCCCCATCCTGCGTAAAGCAGTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC

Fotos / Sonidos

Qué

Hongo Pera (Apioperdon pyriforme)

Observ.

emilita

Fecha

Mayo 1, 2024 a las 01:54 TARDE MDT

Fotos / Sonidos

Observ.

sundwnr

Fecha

Septiembre 17, 2019 a las 11:28 MAÑANA MDT

Fotos / Sonidos

Observ.

jasonheadley

Fecha

Abril 13, 2024 a las 01:47 TARDE MDT

Fotos / Sonidos

Observ.

gabboilard

Fecha

Abril 8, 2024 a las 06:56 TARDE EDT

Descripción

Spores: 11.97-15.01 x 4.32-5.14, Q = 2.66-3.00 (mean = 13.29 x 4.65, Qe = 2.86), n = 8.

Fotos / Sonidos

Qué

Nanacate (Schizophyllum commune)

Observ.

somaclone

Fecha

Marzo 30, 2024 a las 12:55 TARDE ADT

Descripción

Growing on a yellow/swamp birch (Betula alleghaniensis) branch used as a stake in the garden.

Fotos / Sonidos

Qué

Hongo Auricular (Auriscalpium vulgare)

Observ.

bradenjudson

Fecha

Marzo 29, 2024 a las 02:03 TARDE PDT

Fotos / Sonidos

Observ.

carita

Fecha

Junio 7, 2023 a las 11:26 MAÑANA MDT

Descripción

Smells cheesy

Fotos / Sonidos

Observ.

bradenr

Fecha

Junio 20, 2023 a las 11:01 MAÑANA MDT

Fotos / Sonidos

Fecha

Julio 27, 2023 a las 04:02 TARDE MDT

Fotos / Sonidos

Observ.

krschwengler

Fecha

Noviembre 3, 2023 a las 03:24 TARDE CST

Fotos / Sonidos

Observ.

wowokayyes

Fecha

Julio 30, 2023 a las 12:57 TARDE MDT

Fotos / Sonidos

Observ.

mldahl

Fecha

Agosto 19, 2023 a las 09:03 MAÑANA MDT

Fotos / Sonidos

Observ.

mycoastro

Fecha

Agosto 15, 2022 a las 11:12 MAÑANA ADT

Descripción

On forest floor/litter under mature hemlock in an old-growth Eastern hemlock stand.

Basidiospores (3.8) 4.3 - 5.4 (6.3) × (2.0) 2.1 - 2.66 (2.7) µm
Q = (1.6) 1.8 - 2.3 (2.6) ; N = 25
Me = 4.9 × 2.4 µm ; Qe = 2.1

Fotos / Sonidos

Observ.

philipdekat

Fecha

Marzo 13, 2024 a las 06:00 TARDE PDT

Descripción

Sitka spruce, fir, redwood, alder, bay laurel growing in the area.
Fruiting abundantly under redwood trees next to Russ park pond.

Fotos / Sonidos

Observ.

alison_pollack

Fecha

Marzo 4, 2024 a las 02:21 TARDE PST

Fotos / Sonidos

Observ.

leilaniweigand

Fecha

Marzo 1, 2024 a las 10:55 MAÑANA PST

Fotos / Sonidos

Observ.

amyearl

Fecha

Agosto 20, 2023 a las 05:33 TARDE EDT

Fotos / Sonidos

Observ.

acorncap

Fecha

Febrero 2024

Descripción

On manzanita litter

Fotos / Sonidos

Observ.

danmorton

Fecha

Febrero 26, 2024 a las 09:25 MAÑANA PST

Fotos / Sonidos

Observ.

kaedenmacd

Fecha

Agosto 2023

Lugar

Privado

Fotos / Sonidos

Observ.

t0fu

Fecha

Febrero 18, 2024 a las 01:37 TARDE PST

Fotos / Sonidos

Observ.

inthecave

Fecha

Febrero 24, 2024 a las 09:43 MAÑANA PST

Fotos / Sonidos

Observ.

wsundstrom

Fecha

Febrero 23, 2024 a las 04:19 TARDE PST

Fotos / Sonidos

Observ.

jmarmand

Fecha

Julio 15, 2023 a las 10:24 MAÑANA MDT

Fotos / Sonidos

Observ.

raddice

Fecha

Septiembre 11, 2023 a las 02:43 TARDE MDT

Fotos / Sonidos

Observ.

edna27

Fecha

Julio 29, 2020 a las 08:58 TARDE PDT

Fotos / Sonidos

Observ.

scowtan

Fecha

Octubre 8, 2023 a las 04:11 TARDE CDT

Fotos / Sonidos

Qué

Políporo Laberíntico (Cerrena unicolor)

Observ.

sporebloom

Fecha

Diciembre 16, 2023 a las 12:44 TARDE PST

Descripción

Amazing textures and algae integration (?) with maze like elongated pore surface distinct from T. Versicolor

Fotos / Sonidos

Qué

Hongos Coral Y Parientes (Familia Clavariaceae)

Fecha

Julio 22, 2021 a las 05:49 TARDE UTC

Fotos / Sonidos

Observ.

vail

Fecha

Agosto 11, 2023 a las 01:11 TARDE MDT

Descripción

Growing in the moss.
Spermatic smell and mild taste.
7091

Fotos / Sonidos

Observ.

vail

Fecha

Agosto 11, 2023 a las 01:21 TARDE MDT

Descripción

Slimy.
Growing in the moss.
7093

Fotos / Sonidos

Observ.

vail

Fecha

Agosto 9, 2023

Descripción

Strong odor I can't place.
7106

Fotos / Sonidos

Observ.

vail

Fecha

Agosto 11, 2023 a las 10:51 MAÑANA MDT

Descripción

Growing in the moss.
Sweet earthy smell and taste.
7082

Fotos / Sonidos

Observ.

vail

Fecha

Agosto 11, 2023 a las 10:55 MAÑANA MDT

Descripción

Growing in the moss and forest duff.
Sweet earthy smell and taste.
7083

Fungi

Fotos / Sonidos

Qué

Hongos (Reino Fungi)

Observ.

vail

Fecha

Agosto 11, 2023 a las 11:17 MAÑANA MDT

Descripción

Growing in the moss.
Sweet earthy smell and taste.
Looks Amanita, but no vulva/cup.
Infected Russula (Hypomyces?)
7084

Fotos / Sonidos

Observ.

vail

Fecha

Agosto 11, 2023 a las 01:43 TARDE MDT

Descripción

Growing in the forest duff.
7094

Fotos / Sonidos

Observ.

vail

Fecha

Agosto 11, 2023 a las 11:48 MAÑANA MDT

Descripción

Growing in the forest duff and weeds.
Mild smell and slight watermelon rind taste.
7087

Fotos / Sonidos

Observ.

vail

Fecha

Agosto 11, 2023 a las 12:19 TARDE MDT

Descripción

Growing in the moss.
Mild smell and taste.
7089

Fotos / Sonidos

Observ.

vail

Fecha

Agosto 11, 2023 a las 12:01 TARDE MDT

Descripción

Growing in the moss and forest duff.
Sweet earthy smell and taste.
7088

Fotos / Sonidos

Observ.

d_wood12

Fecha

Septiembre 19, 2020 a las 10:24 MAÑANA MDT

Fotos / Sonidos

Observ.

d_wood12

Fecha

Septiembre 11, 2019 a las 05:01 TARDE MDT

Descripción

Growing with Populus tremuloides.

Fotos / Sonidos

Observ.

d_wood12

Fecha

Septiembre 11, 2019 a las 05:46 TARDE MDT

Descripción

Growing with Populus tremuloides.

Fotos / Sonidos

Fecha

Agosto 27, 2023 a las 11:36 MAÑANA MDT

Fotos / Sonidos

Fecha

Septiembre 1, 2023 a las 04:58 TARDE MDT