On native giant reed. Tentative ID. People I've talked to in the MN DNR who are Invasive Species Specialists report that this fungus doesn't affect the non-native population here in the state
I believe this is fungal in origin with spore capsules at the termini. The strands are about 2 inches (5 cm) in length. Growing from (possibly) bird droppings in an outdoor flower pot.
Puccinia cnici-oleracei?
Of the various kinds of organisms that cause plant disease, plant-parasitic algae are not the norm: the only species common in the USA is this one, a plant pathogen infecting tea, coffee, and coconut plants, causing algal or rust algal leaf spot (a.k.a green scurf) on over 200 plant species (more than 60 families) from NC to FL and into TX, most commonly plants with somewhat leathery leaves, like this magnolia, or camellia & holly
Older algal colonies that become colonized (lichenized) by a fungus turn into leaf spot lichens, composite organisms of an alga and a fungus, then classified in the genus Strigula, the only lichen parasitic on plants, most visible on leaves, but also twigs & branches, even fruit, the crusty gray-green to greenish-brown color circular/blotchy spots generally somewhat raised from the plant surface, the edges often wavy or feathered; however, in summer, when the alga reproduces, the spots turn a velvety red-brown due to the production of reddish, spore-producing structures... numerous colonies can cause premature yellowing and loss of leaves
They have multiplied significantly in the sample over the last 2 days.
Isolated from soil collected in a walnut grove. Oomycetes were baited by soaking soil in sterilized pond water with radish seed and other baits. Radish seed was placed in a hole cut in plate of water agar, and the hyphae that emerged were transferred to cornmeal agar.
ITS sequence:
GAGATTTTCGTGCGTGTTTGTGGTATCGCTATGTATTCGTACGTGGCGTTAGCAAGCATTGTATGGAGCTTGGCTGATCGAAGGTCGGTGCACACCTTGTGTGTGTGTTGGCTGATTAACCTTTCAAACCCTTTCAATAAATACTGATTATACTGTGAGGACGAAAGTCTTTGCTTTTATCTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATACCTGGAAGTATGTCTGTATCAGTGTCCGTACATCAAACTTGCCTCTTTTTGTCGGTGTAGTCCGATCGAGAGTATGGCAGACGTGAGGTGTCTCGCGACTCGTATATCATTGTGTGTGTAAATCGTAAGAGATACATACAGAAGGTAGTATATAACTTGTTGCGAGTCCCTTTAAAACGACACGATCTTTCTATTTGCTTTCTATGGAGCGTGTATTTCGAACGCGGTGGTCCTCGGATCGCTTGCAGTCGGCAGCGACTTCAGTGAAGACATAGTGAAGAAACCTCTATTCGCGGTACGTTAGGCTTCGGCTCGACAATGTTGCGTTCTAGTGTGTGGACTCCGTTTTCGCTTTGAGGTGTACTGTTCGGTTGTGGGTTTGAGCCTTGGTATTGCTTTGTTAGTAGAGATATCTCGATTTTCTGTAGTTTGATTCTGCATACACGCAAGTGTGTGTGGGTAGAGAGTATCTATTTGGGAAATTTTGTACTGCGTGCGCTTTCGAGTGTGTGTATGTATCTCAATTGGACCTGATATCAGACAAGACTACCCGCTGAACTTAA
BLAST hits with >99% ID to Pythium sp., P. longandrum, and P. urmium.