Ícono
Fotos / Sonidos
Especie / Nombre del taxón
Observador
Lugar
Acciones

Fotos / Sonidos

Qué

Foca Común Phoca vitulina

Observ.

gillessanmartin

Fecha

Octubre 31, 2017 02:56 PM CET

Etiquetas

Fotos / Sonidos

Qué

Blanca del Majuelo Aporia crataegi

Observ.

gillessanmartin

Fecha

Mayo 14, 2019

Descripción

Aporia crataegi caterpillar

Fotos / Sonidos

Square

Qué

Nazarena Favonius quercus

Observ.

gillessanmartin

Fecha

Mayo 20, 2019

Descripción

Neozephyrus quercus catepillar on oak (Quercus sp.)

Fotos / Sonidos

Observ.

gillessanmartin

Fecha

Mayo 20, 2019

Descripción

Orthosia cruda caterpillar on oak (Quercus sp.)

ID based on barcoding :
CRAW_ID : AB2019_03_A003_01
Consensus and clipped sequence for COI from LCO/HCO primers :

TTTATTTTTGGATTTGAGCTGGAATAGTTGGAACTTCATTAAGATTGTTAATTCGAGCCGAATTAGGAAACCCTGGATCTTTAATTGGAGATGATCAAATCTATAATACTATTGTAACAGCGCATGCCTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTCGGCAATTGACTTGTTCCATTAATATTAGGTGCCCCTGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGACTTCTACCCCCCTCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACGGTATATCCCCCCCTTTCGTCTAACATTGCTCACGGAGGAAGATCTGTTGACTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCCTCTATTTTAGGAGCTATTAACTTTATTACTACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCAGTAGGTATTACTGCATTTTTATTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATCTAAATACATCCTTTTTTGATCCTGCAGGAGGAGGAGATCCAATTT

Etiquetas

Fotos / Sonidos

Observ.

gillessanmartin

Fecha

Mayo 20, 2019

Descripción

Psoricoptera gibbosella caterpillar on oak (Quercus sp.)

ID based on barcoding :
CRAW_ID : AB2019_03_A004_01
Consensus and clipped sequence for COI from LCO/HCO primers :

ATTTTATTTTTGGAATTTGA-GCAGGTATAGT TGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGGTTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCTCTTACTTTACTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACTGGATGAACAGTTTATCCCCCTCTTTCTTCTAATATTGCTCATGGTGGTAGATCAGTTGATTTAGCCATTTTTTCTCTTCATTTAGCTGGAATTTCTTCTATTTTAGGGGCAATTAATTTTATTACAACTATTATTAATATAAAAATTAATGGATTATCTTTTGATCAAATACCCCTATTTGTTTGAGCAGTAGGAATTACCGCTTTATTACTACTTTTATCTCTTCCTGTATTAGCTGGAGCAATTACTATATTATTAACTGATCGTAATTTAAATACCTCATTCTTTGATCCTGCAGGAGGAGGAGATC

Fotos / Sonidos

Qué

Oruga de la Piel Operophtera brumata

Observ.

gillessanmartin

Fecha

Mayo 20, 2019 02:20 AM SAST

Descripción

Operophtera brumata caterpillar on oak (Quercus sp.)

ID based on barcoding :
CRAW_ID : AB2019_03_A005_01
Consensus and clipped sequence for COI from LCO/HCO primers :

CTTTATTTTTGGAATTTGAGCCGGTATAATTGGAACTTCACTAAGTTTATTAATTCGAGCTGAATTAGGTAACCCTGGTTCTTTAATTGGGGATGACCAAATTTACAACACTATTGTTACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATACTTGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCTCCCTCTATTACTCTTTTAATTTCTAGAAGAATTGTAGAAAATGGGGCAGGAACTGGATGAACTGTTTACCCCCCTTTATCTTCTAATATTGCCCATGGAGGAAGATCCGTAGATCTAGCTATCTTTTCTCTTCATTTAGCTGGTATTTCCTCAATTTTAGGTGCAATTAACTTTATTACCACTATTATCAATATACGATTAAATAATATATTTTTTGACCAATTACCATTATTTGTTTGAGCTGTAGGAATCACAGCATTTTTACTTTTATTGTCATTACCAGTATTAGCGGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTCGATCCTGCTGGGGGGGGAGATCCTATTCTT

Fotos / Sonidos

Observ.

gillessanmartin

Fecha

Mayo 20, 2019 02:20 AM SAST

Descripción

Epirrita dilutata on oak (Quercus sp.).

ID based on barcoding :
CRAW_ID : AB2019_03_A003_03_01
Consensus and clipped sequence for COI from LCO/HCO primers :

GCCCCCATCAATTACCCTTTTAATTTCTAGAAGAATTGTAGAAAATGGGGCTGGAACTGGATGAACTGTCTATCCCCCTTTATCCTCTAATATTGCCCATGGGGGAAGCTCCGTAGATTTGGCTAT

Fotos / Sonidos

Square

Qué

Mapache Procyon lotor

Observ.

gillessanmartin

Fecha

Noviembre 23, 2019 04:25 PM CET

Etiquetas

Fotos / Sonidos

Observ.

gillessanmartin

Fecha

Octubre 26, 2019 05:42 PM CEST

Etiquetas

Fotos / Sonidos

Square

Qué

Hongo Oreja de Ratón Helvella crispa

Observ.

gillessanmartin

Fecha

Octubre 26, 2019 04:02 PM CEST

Etiquetas

Fotos / Sonidos

Square

Qué

Rata Gris Asiática Rattus norvegicus

Observ.

gillessanmartin

Fecha

Noviembre 2, 2019 03:42 PM CET

Etiquetas

leo

Fotos / Sonidos

Observ.

gillessanmartin

Fecha

Septiembre 28, 2019 12:02 AM CEST

Descripción

Brachymeria cfr tibialis (eg because of the color of the tibiae and the absence of notch on the scutellum)

Etiquetas

Fotos / Sonidos

Observ.

gillessanmartin

Fecha

Septiembre 27, 2019 06:39 PM CEST

Etiquetas

Fotos / Sonidos

Square

Observ.

gillessanmartin

Fecha

Septiembre 27, 2019 04:16 PM CEST

Descripción

Symphyta larva on Rosa canina.
Emphytus ? Endelomyia ? Tenthredo ?

Fotos / Sonidos

Observ.

gillessanmartin

Fecha

Septiembre 27, 2019 03:25 PM CEST

Descripción

Priophorus brullei on Rubus idaeus

Fotos / Sonidos

Observ.

gillessanmartin

Fecha

Septiembre 27, 2019 05:52 PM CEST

Etiquetas

Fotos / Sonidos

Observ.

gillessanmartin

Fecha

Septiembre 27, 2019 05:48 PM CEST

Descripción

Cochlodina laminata ?

Fotos / Sonidos

Square

Observ.

gillessanmartin

Fecha

Septiembre 27, 2019 05:47 PM CEST

Fotos / Sonidos

Square

Qué

Conchinilla Brillante Oniscus asellus

Observ.

gillessanmartin

Fecha

Septiembre 27, 2019 05:46 PM CEST

Fotos / Sonidos

Qué

Zancudos Gigantes Familia Tipulidae

Observ.

gillessanmartin

Fecha

Septiembre 27, 2019 01:29 PM CEST

Fotos / Sonidos

Observ.

gillessanmartin

Fecha

Septiembre 24, 2019 12:14 AM CEST

Fotos / Sonidos

Square

Observ.

gillessanmartin

Fecha

Septiembre 15, 2019 04:27 PM CEST

Descripción

Eriophyes viburni gall on Viburnum lantana

Etiquetas

Fotos / Sonidos

Qué

Avispa Asiática Vespa velutina

Observ.

gillessanmartin

Fecha

Noviembre 8, 2019 06:01 PM CET

Descripción

Vespa velutina nest (on top of the tree seen on the second picture).
At <50m from the apiary of a local beekeeping school.

Fotos / Sonidos

Observ.

gillessanmartin

Fecha

Octubre 13, 2019 10:52 PM CEST

Fotos / Sonidos

Qué

Chinche Americana del Pino Leptoglossus occidentalis

Observ.

gillessanmartin

Fecha

Octubre 13, 2019 10:41 PM CEST

Fotos / Sonidos

Observ.

gillessanmartin

Fecha

Octubre 13, 2019 03:10 PM CEST

Descripción

Maybe Mucilago crustacea ?

Fotos / Sonidos

Square

Observ.

gillessanmartin

Fecha

Octubre 12, 2019 03:03 PM CEST

Descripción

Feeding on ivy flowers

Fotos / Sonidos

Qué

Almirante Naranja Vanessa atalanta

Observ.

gillessanmartin

Fecha

Octubre 12, 2019 02:26 PM CEST

Fotos / Sonidos

Square

Qué

Chinche Hedionda Gris Rhaphigaster nebulosa

Observ.

gillessanmartin

Fecha

Octubre 11, 2019 05:43 PM CEST

Fotos / Sonidos

Qué

Hongos de Miel Género Armillaria

Observ.

gillessanmartin

Fecha

Octubre 11, 2019 04:36 PM CEST

Descripción

Armillaria

Etiquetas

Fuentes:: Átomo